Java Games: Flashcards, matching, concentration, and word search.

Chapter 12: DNA

Review the Structure of DNA and Replication of DNA

AB
The shape of the DNA molecule; like a spiral staircaseDouble Helix
The building blocks of Nucleic AcidsNucleotides
DNA stands forDeoxyribonucleic Acid
Three parts of a NucleotidePhosphate , sugar, and nitrogen base
The five carbon sugar in DNADeoxyribose
The four nitrogen bases in DNAAdenine, Thymine, Cytosine, and Guanine
Process that makes a copy of DNADNA Replication
The "sides" of the DNA "ladder" are made ofSugars and Phosphates
The "rungs" of the DNA "ladder" are made ofNitrogen Bases
Which nitrogen base pairs with Adenine?Thymine
Which nitrogen base pairs with CytosineGuanine
Enyzme that breaks the hydrogen bonds between nitrogen basesDNA Helicase
Enzyme that adds nucleotides to form the two new Double HelixesDNA Polymerase
What is the complementary strand of this DNA molecule? TACGGCTTACCGTTAATGCCGAATGGCAAT
Who discovered the 3D structure of the DNA double helix?Watson and Crick
Who discovered that A=T and C=G in DNA?Chargaff
Who used x-rays to discover that a DNA molecule resembled a tightly coiled helix?Franklin and Wilkins
Where is DNA found in a cell?Nucleus


Science Specialist
Friendswood High School
Friendswood, TX

This activity was created by a Quia Web subscriber.
Learn more about Quia
Create your own activities